Journal Mobile Options
Table of Contents
Vol. 114, No. 4, 2010
Issue release date: April 2010
Section title: Original Paper
Nephron Clin Pract 2010;114:c260–c267
(DOI:10.1159/000276578)

Common Apolipoprotein E Gene Mutations Contribute to Lipoprotein Glomerulopathy in China

Han J.a · Pan Y.a · Chen Y.a · Li X.b · Xing G.c · Shi J.d · Hou P.a · Zhang H.a · Wang H.a
aRenal Division, Peking University, First Hospital and bRenal Division, Traditional Chinese Medicine University, Dongzhimen Hospital, Beijing, cRenal Division, First Hospital, Qingdao Medical University, Qingdao, and dRenal Division, Tanggu Hospital, Tianjin, China
email Corresponding Author

Abstract

Background: Lipoprotein glomerulopathy (LPG) is a unique disease characterized by thrombus-like lipoprotein deposition in glomeruli and an increased serum apolipoprotein E level (ApoE protein or APOE gene). Several APOE mutations contribute to the occurring of LPG. Methods: We confirmed LPG in 7 individuals by renal biopsy, and investigated families of 2 patients with urinalysis, serum creatinine and serum lipid examination. Exons of APOE of all individuals as well as their relatives were amplified and sequenced directly. Results: Two types of APOE mutations were identified in the 7 patients and their relatives. APOE Maebashi (Arg142-Leu144→0) heterozygotes were found in 5 individuals who were from 4 different families. APOE Kyoto (Arg25-Cys) was confirmed heterogeneous in another 2 individuals. Both mutations present incomplete penetrance. Conclusion: Our research indicates that APOE Maebashi (Arg142-Leu144→0) is a common mutation in Chinese LPG. However, not all carriers of the 2 mutations have LPG, although hyperlipidemia and high serum ApoE level are tested. There are likely other reasons, such as a local mechanism in the glomeruli, which participated in the renal injury.

© 2010 S. Karger AG, Basel


  

Key Words

  • Lipoprotein glomerulopathy
  • Apolipoprotein E
  • APOE mutations

 Introduction

Lipoprotein glomerulopathy (LPG) is a rare disease characterized by intraglomerular lipoprotein thrombi and abnormal lipid metabolism [1,2]. Abnormalities in the apolipoprotein E (APOE) gene have been suspected in the pathogenesis of LPG. The major physiological role of the APOE gene (OMIM+107741) is to mediate the binding of lipoproteins to the low-density lipoprotein (LDL) receptors and chylomicron remnant receptors. The binding site of the ApoE protein to LDL receptors lies between the 140th and 160th amino acid residues [3,4], and several APOE mutations around this region have been reported to be associated with LPG [5,6,7,8,9] and dysbetalipoproteinemia, such as APOE Sendai (Arg145- Pro), APOE Kyoto (Arg25-Cys), APOE Tokyo (141Arg-143Leu→0), APOE (156Gln-173Gly→0) and APOE Maebashi (142Arg-144Leu→0). Series studies about APOE Sendai strongly demonstrated that glomerular lesions are not only due to hyperlipidemia, but also due to in situ interaction between mutant ApoE protein with glomeruli [10,11]. In addition, some researchers indicated the location of mutations in the ApoE protein was one of the important determinants for the development of LPG [12].

In this study, we investigated the APOE mutations in 7 individuals who have been confirmed with LPG via renal biopsy, and screened 3 families.

 Methods


 Subjects

Subjects were patients who accepted renal biopsy in the Renal Division, Peking University First Hospital. They were 12- to 42-year-old Chinese (n = 7), consisted of 2 males and 5 females, with proteinuria and a diagnosis of LPG, documented by a serum creatinine 75.6 ± 6.1 µmol/l, 6/7 elevated ApoE level and 3/6 elevated apolipoprotein B (ApoB) level. The renal pathological examinations showed enlarged glomerular capillaries deposited with pale stain substances, which could be stained by red oil O. Electron microscopy revealed that the capillary lumina in the glomeruli were occupied by granules and vacuoles of various sizes (fig. 1). Clinically, all individuals presented proteinuria (4 of them had nephritic syndrome) and a normal range of serum creatinine. All of them showed increased serum lipids and high levels of serum ApoE, however only 3 individuals were companied by high ApoB levels (table 1). Subject A and B came from the same family, while another 6 subjects appeared to be sporadic. We screened 3 families, including urinary analysis serum creatinine, serum lipid and serum lipoproteins E and B (fig. 2, 3, 4).

TAB01
Table 1. The clinical features and mutations of 7 patients

FIG01
Fig. 1.a Light microscopy findings of renal biopsy specimen of patient C (red oil stain, color available online only). The capillary lumina of most glomeruli showed a marked dilatation and were filled with thrombi stained by red oil. b Light microscopy findings of renal biopsy specimen of patient C (periodic acid silver methenamine). Most glomeruli presented dilatation of the capillary lumen and ApoE thrombi deposits. c Electron-microscopic findings of thrombi-like substances in renal biopsy specimen of patient C.

FIG02
Fig. 2. Pedigree analysis of family A. Pedigree analyses of patients A and B were presented with clinical characteristics and APOE mutation status. Arrows indicate the patients in the family.

FIG03
Fig. 3. Pedigree analysis of family C. Pedigree analysis of patient C was presented with clinical characteristics and APOE mutation status. Arrow indicates the patient in the family. Grey square and circle indicate carriers without proteinuria or abnormal serum creatinine.

FIG04
Fig. 4. Pedigree analysis of family G. Pedigree analysis of patient G was presented with clinical characteristics and APOE mutation status. Arrow indicates the patient in the family. Grey circle indicates carrier without proteinuria or abnormal serum creatinine.

 Mutation Screening of APOE Gene

We were able to ascertain, obtain consent, and prepare genomic DNA from blood leukocytes collected from 7 participants and 3 families in this study. Each subject gave informed, written consent to the local institutional review boards. Genomic DNA was prepared from leukocytes in EDTA-anticoagulated blood. The human reference genome sequence was obtained from the UCSC Genome Browser (http://genome.ucsc.edu). PCR was performed with primers F4 5′ ACAGAATTCGCCCCGGCCTGGTACAC 3′ and F6 5′ TAACCTTGGCAGGGCTGTCCAAGGA 3′, 5′ TTTGTGGAGCACCTTCTGTG 3′, 5′ GCAGAATGAAACCTGGACCT 3′ for exon 3, and 5′ ATCAAGCTTTCGCCCGCCCCATCCC AGCCCTTC 3′, 5′ CGTGAATTCGCATGGCTGCAGGCTTCGGCGTTC 3′ for exon 4. Ten pmol of each primer and 200 ng genomic DNA were mixed in a 25 µl reaction mixture consisting of 0.2 mM dNTPs, TaKaRa LA Taq 0.5 u and GC buffer for amplification of template with a high percentage of GC (TaKaRa Bio. Co., Ltd., Japan). The mixture was incubated at 96°C for 10 min, then PCR was amplified as follows: denaturing at 96°C for 30 s, annealing at 65°C for 30 s and polymerization at 72°C for 30 s for 30 cycles using a thermocycler. For exon 3, touchdown PCR was used as 65°C→50°C for 30 cycles with 50°C for 15 cycles. Genotypes were scored by direct sequencing in all participants as well as their family members. When mutations were found in subjects, restriction fragment isotyping with HhaI (Hixson and Vernier) combined with direct sequencing were performed to confirm the distribution of mutations in the indicated families. Data from 200 healthy Chinese Han persons were considered as controls.

 Results


 APOE Gene Characteristics in Study Participants

Two types of APOE mutations were identified in the 7 participants. A 3 amino acid deletion (142Arg-144Leu→0) was detected in 5 individuals and a missense mutation of APOE Arg25-Cys was found in 2 individuals (table 1). Based on genotypes confirmed by direct sequencing and restriction fragment length polymorphism analysis, we concluded that the 3 amino acid deletion (142Arg-144Leu→0) occurred in ε3 (table 1, fig. 2, 3), and Arg25-Cys occurred in ε3 in individual G (fig. 4). However, we could not confirm which allele the Arg25-Cys was located in, due to a lack of family data.

To estimate the occurrence of the Arg25-Cys and 142Arg-144Leu→0 mutations in the Chinese population, genotyping was performed in 200 Chinese Han persons who did not presented any evidence of LPG or abnormal serum lipids. None of them was identified in either of the 2 mutations.

 Clinical and APOE Gene Characteristics in Families

We investigated 3 families (family A, C and G) in this research. In family A, both mother and son were diagnosed with LPG (fig. 2). In family C, the APOE mutation (142Arg-144Leu→0) was detected in 3 individuals (I:2, II:3 and II:5). Only individual C (family member II:5) was identified with LPG; another 2 persons, I:2 and II:3, did not show any sign of abnormal urine and serum creatinine (fig. 3). We observed similar phenomena in family G, where both I:2 and II:1 carried the APOE Arg25-Cys, but only II:1 was confirmed with LPG (fig. 4). In those APOE mutation carriers, although they did not manifest with renal disease clinically, the serum lipids and ApoE level were markedly elevated.

 Three Years’ Follow-Up for Individual C and Family Members

We followed the family of individual C for 2 years. Patient C first accepted therapy of prednisone 50 mg per day and simvastatin 200 mg for 3 months without any remission of nephrotic syndrome. Then prednisone was gradually decreased and leflunomide was added, for another 6 months, the nephrotic syndrome was improved completely, and all treatments were stopped. Proteinuria was negative for 3 years. Her mother and brother who carry the heterozygous APOE 142Arg-144 Leu→0 have not been found to have abnormal proteinuria or serum creatinine.

 Discussion

Many researches suggested that the APOE gene may play an important role in the pathogenesis of LPG, and several mutations of the APOE gene have been identified to be associated with LPG. Although most of the cases of LPG come from Asia, mutations of APOE associated with LPG from China appeared to be different from Japan. Chen et al. [13 ] did not identify any APOEgene mutations in 17 LPG patients, while only 10 variation sites in the non-coding regions were identified. Luo et al. [14 ] confirmed a new type of APOE mutation, APOE Guangzhou (Arg150 Pro). In this study, we identified 2 types of APOE mutations among 7 Chinese patients with LPG. APOE Maebashi (142Arg-144Leu→0) was detected in 5 patients from 4 different families, and APOE Kyoto (Arg25-Cys) was confirmed in 2 patients.

APOE Maebashi (142Arg-144Leu→0) [8] has been reported in a Japanese girl. APOE Kyoto (Arg25-Cys) [7] was originally described in a Japanese man with LPG and was identified totally in 4 Asians and 2 European-Americans (table 2) [1]. APOE Maebashi appears to be more common in Chinese LPG patients based on our study.

TAB02
Table 2. Mutations of APOE gene contribute to LPG

Studies showed that the mutations of APOE were transmitted as autosomal dominant with incomplete penetrance [5,7,8] with unclear mechanisms. We also observed a similar phenomenon in our LPG families. Both APOE Maebashi and APOE Kyoto heterozygous carriers showed abnormal serum lipids and elevated serum APOE level, without signs of renal disease. More interestingly, patient C got a complete remission of nephrotic syndrome after 6 months of treatment with a steroid and leflunomide, with no proteinuria for more than 3 years. In most of the reported cases, lipid-lowering therapy was the first choice and appeared to be effective in patients with less proteinuria after a long period of treatment (table 2). In our observations, patient C did not show any signs of remission of nephritic syndrome after simvastatin treatment for 3 months.

These phenomena suggest that some other possibility, such as a local mechanism in glomeruli, participated in renal lesion formation. Case series studies of APOE Sendai strongly demonstrated that glomerular lesions are not only caused by hyperlipidemia, but also by in situ interaction between mutant ApoE with the glomeruli [15,16]. Furthermore, prior research illustrated the location of mutations in the ApoE protein is one of the important determinants for the development of LPG [17].

Based on the family investigations, all the carriers who did not show any sign of proteinuria or renal failure had normal ApoB level compared with the patients in these families. It was reported that concentrations of ApoB correlated with urine protein in a study of 16 LPG cases [16] and ApoB was also detected in the lipoprotein deposition in the enlarged glomeruli. It was shown that the high levels of ApoB can lead to plaques that can result in atherosclerosis. Interestingly, ApoB secretion was dependent on APOE binding to receptors [15]. These findings suggest that the ApoB level may be one of the factors leading to renal lesion formation in LPG. However, not all the patients with LPG had a high ApoB level both in our and other studies. The roles of ApoB and APOE on the renal lesion still need to be investigated.

In most of the reported cases, long-time treatment with statins or bezafibrate appeared to decrease proteinuria. It appeared that leflunomide played a role in the remission of patient C’s nephrotic syndrome. Local inflammation might be involved in the mechanism of LPG and immunosuppressive therapy might act on this step, resulting in the remission of proteinuria.

In summary, both APOE Maebashi (142Arg-144Leu→0) and APOE Kyoto (Arg25-Cys) heterozygous exist in Chinese LPG patients, and APOE Maebashi appears more common. Both types of mutations are not sufficient to result in clinical LPG. Immunosuppressants and lipid-lowering agents might ameliorate proteinuria.

 Acknowledgements

Support was provided through the Grant for Capital Medical Development (ZD199910, 2003–2001) and the Grant for Excellent Scientist 985–2-007–113.


References

  1. Rovin B, Roncone D, McKinley A, Nadasdy T, Korbert S, Schwartz M: APOE Kyoto mutations in European Americans with lipoprotein glomerulopathy. N Engl J Med 2007;357:2522–2524.
  2. Saito T, Matsunaga A, Oikawa S: Impact of lipoprotein glomerulopathy on the relationship between lipids and renal diseases. Am J Kidney Dis 2006;47:199–211.
  3. de Knijff P, van den Maagdenberg A, Frants R, Havekes L: Genetic heterogeneity of apolipoprotein E and its influence on plasma lipid and lipoprotein levels. Hum Mutat 1994;4:178–194.
  4. Lalazar A, Weisgraber K, SC.Jr R, Giladi H, Innerarity T, Levanon A, Boyles J, Amit B, Gorecki M, Mahley R, Vogel T: Site-specific mutagenesis of human apolipoprotein E: receptor binding activity of variants with single amino acid substitutions. J Biol Chem 1988;263:3542–3545.
  5. Ando M, Sasaki J, Hua H, Matsunaga A, Uchida K, Jou K, Oikawa S, Saito T, Nihei H: A novel 18-amino acid deletion in apolipoprotein E associated with lipoprotein glomerulopathy. Kidney Int 1989;56:1317–1323.

    External Resources

  6. Konishi K, Saruta T, Kuramochi S, Oikawa S, Saito T, Han H, Matsunaga A, Sasaki J: Association of a novel 3-amino acid deletion mutation of apolipoprotein E (Apo E Tokyo) with lipoprotein glomerulopathy. Nephron 1999;83:214–218.
  7. Matsunaga A, Sasaki J, Komatsu T, Kanatsu K, Tsuji E, Moriyama K, Koga T, Arakawa K, Oikawa S, Saito T, Kita T, Doi T: A novel apolipoprotein E mutation, e2 (Arg25Cys), in lipoprotein glomerulopathy. Kidney Int 1999;56:421–427.
  8. Ogawa T, Maruyama K, Hattori H, Arai H, Kondoh I, Egashira T, Watanabe T, Kobayashi Y, Morikawa A: A new variant of apolipoprotein E (Apo E Maebashi) in lipoprotein glomerulopathy. Pediatr Nephrol 2000;14:149–151.
  9. Oikawa S, Matsunaga A, Saito T, Sato H, Seki T, Hoshi K, Hayasaka K, Kotake H, Midorikawa H, Sekikawa A, Hara S, Abe K, Toyota T, Jingami H, Nakamura H, Sasaki J: Apolipoprotein E Sendai (arginine 145–>proline): a new variant associated with lipoprotein glomerulopathy. J Am Soc Nephrol 1997;8:820–823.
  10. Hoffmann M, Scharnagl H, Panagiotou E, Banghard W, Wieland H, März W: Diminished LDL receptor and high heparin binding of apolipoprotein E2 Sendai associated with lipoprotein glomerulopathy. J Am Soc Nephrol 2001;12:524–530.
  11. Ishigaki Y, Oikawa S, Suzuki T, Usui S, Magoori K, Kim D, Suzuki H, Sasaki J, Sasano H, Okazaki M, Toyota T, Saito T, Yamamoto T: Virus-mediated transduction of apolipoprotein E (APOE)-Sendai develops lipoprotein glomerulopathy in APOE-deficient mice. J Biol Chem 2000;275:31269–31273.
  12. Murano T, Matsumura R, Misawa Y, Ozaki H, Miyashita Y, Yoshida S, Sueioshi M, Sugiyama T, Shirai K: Interaction of endothelial cells and triglyceride-rich lipoproteins with apolipoprotein E (arg–>cys) from a patient with lipoprotein glomerulopathy. Metabolism 2002;51:201–205.
  13. Chen S, Liu ZH, Zheng JM, Zhang X, Li LS: A complete genomic analysis of the apolipoprotein E gene in Chinese patients with lipoprotein glomerulopathy. J Nephrol 2007;20:568–575.
  14. Luo B, Huang F, Liu Q, Li X, Chen W, Zhou SF, Yu X: Identification of apolipoprotein E Guangzhou (arginine 150 proline), a new variant associated with lipoprotein glomerulopathy. Am J Nephrol 2008;28:347–353.
  15. Blasiole D, Older A, Attie A: Regulation of ApoB secretion by the LDL receptor requires exit from the endoplasmic reticulum and interaction with ApoE and ApoB. J Biol Chem 2008;283:11374–11381.
  16. Zhang B, Liu Z, Zeng C, Zheng J, Chen H, Li L: Clinicopathological and genetic characteristics in Chinese patients with lipoprotein glomerulopathy. J Nephrol 2008;21:110–117.
  17. Ieiri N, Hotta O, Taguma Y: Resolution of typical lipoprotein glomerulopathy by intensive lipid-lowering therapy. Am J Kidney Dis 2003;41:244–249.
  18. Oikawa S, Suzuki N, Sakuma E, Saito T, Namai K, Kotake H, Fujii Y, Toyota T: Abnormal lipoprotein and apolipoprotein pattern in lipoprotein glomerulopathy. Am J Kidney Dis 1991;18:553–558.
  19. Matsunaga A, Furuyama M, Hashimoto T, Toyoda K, Ogino D, Hayasaka K: Improvement of nephrotic syndrome by intensive lipid-lowering therapy in a patient with lipoprotein glomerulopathy. Clin Exp Nephrol 2009 Jul 15 [Epub ahead of print].
  20. Maruyama K, Arai H, Ogawa T, Tomizawa S, Morikawa A: Lipoprotein glomerulopathy: a pediatric case report. Pediatr Nephrol 1997;11:213–214.
  21. Cheung CY, Chan AO, Chan YH, Lee KC, Chan GP, Lau GT, Shek CC, Chau KF, Li CS: A rare cause of nephrotic syndrome: lipoprotein glomerulopathy. Hong Kong Med J 2009;15:57–60.
  22. Kinomura M, Sugiyama H, Saito T, Matsunaga A, Sada KE, Kanzaki M, Takazawa Y, Maeshima Y, Yanai H, Makino H: A novel variant apolipoprotein E Okayama in a patient with lipoprotein glomerulopathy. Nephrol Dial Transplant 2008;23:751–756.
  23. Hagiwara M, Yamagata K, Matsunaga T, Arakawa Y, Usui J, Shimizu Y, Aita K, Nagata M, Koyama A, Zhang B, Mastunaga A, Saku K, Saito T: A novel apolipoprotein E mutation, ApoE Tsukuba (arg 114 cys), in lipoprotein glomerulopathy. Nephrol Dial Transplant 2008;23:381–384.

  

Author Contacts

Yuqing Chen
Renal Division, Peking University, First Hospital
No.8, Xishiku Street, Xicheng District, Beijing, 100034 (China)
Tel. +86 10 6655 1122 2388, Fax +86 10 6655 1055
E-Mail chenyuqing112@hotmail.com

  

Article Information

J.H. and Y.P. contributed equally to this paper.

Received: April 27, 2009
Accepted: September 16, 2009
Published online: January 20, 2010
Number of Print Pages : 8
Number of Figures : 4, Number of Tables : 2, Number of References : 23

  

Publication Details

Nephron Clinical Practice

Vol. 114, No. 4, Year 2010 (Cover Date: April 2010)

Journal Editor: El Nahas M. (Sheffield)
ISSN: 1660-2110 (Print), eISSN: 1660-2110 (Online)

For additional information: http://www.karger.com/NEC


Copyright / Drug Dosage / Disclaimer

Copyright: All rights reserved. No part of this publication may be translated into other languages, reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, microcopying, or by any information storage and retrieval system, without permission in writing from the publisher or, in the case of photocopying, direct payment of a specified fee to the Copyright Clearance Center.
Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in goverment regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug.
Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.

Abstract

Background: Lipoprotein glomerulopathy (LPG) is a unique disease characterized by thrombus-like lipoprotein deposition in glomeruli and an increased serum apolipoprotein E level (ApoE protein or APOE gene). Several APOE mutations contribute to the occurring of LPG. Methods: We confirmed LPG in 7 individuals by renal biopsy, and investigated families of 2 patients with urinalysis, serum creatinine and serum lipid examination. Exons of APOE of all individuals as well as their relatives were amplified and sequenced directly. Results: Two types of APOE mutations were identified in the 7 patients and their relatives. APOE Maebashi (Arg142-Leu144→0) heterozygotes were found in 5 individuals who were from 4 different families. APOE Kyoto (Arg25-Cys) was confirmed heterogeneous in another 2 individuals. Both mutations present incomplete penetrance. Conclusion: Our research indicates that APOE Maebashi (Arg142-Leu144→0) is a common mutation in Chinese LPG. However, not all carriers of the 2 mutations have LPG, although hyperlipidemia and high serum ApoE level are tested. There are likely other reasons, such as a local mechanism in the glomeruli, which participated in the renal injury.

© 2010 S. Karger AG, Basel


  

Author Contacts

Yuqing Chen
Renal Division, Peking University, First Hospital
No.8, Xishiku Street, Xicheng District, Beijing, 100034 (China)
Tel. +86 10 6655 1122 2388, Fax +86 10 6655 1055
E-Mail chenyuqing112@hotmail.com

  

Article Information

J.H. and Y.P. contributed equally to this paper.

Received: April 27, 2009
Accepted: September 16, 2009
Published online: January 20, 2010
Number of Print Pages : 8
Number of Figures : 4, Number of Tables : 2, Number of References : 23

  

Publication Details

Nephron Clinical Practice

Vol. 114, No. 4, Year 2010 (Cover Date: April 2010)

Journal Editor: El Nahas M. (Sheffield)
ISSN: 1660-2110 (Print), eISSN: 1660-2110 (Online)

For additional information: http://www.karger.com/NEC


Article / Publication Details

First-Page Preview
Abstract of Original Paper

Received: 4/27/2009
Accepted: 9/16/2009
Published online: 1/20/2010
Issue release date: April 2010

Number of Print Pages: 1
Number of Figures: 4
Number of Tables: 2

ISSN: (Print)
eISSN: 1660-2110 (Online)

For additional information: http://www.karger.com/NEC


Copyright / Drug Dosage

Copyright: All rights reserved. No part of this publication may be translated into other languages, reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, microcopying, or by any information storage and retrieval system, without permission in writing from the publisher or, in the case of photocopying, direct payment of a specified fee to the Copyright Clearance Center.
Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in goverment regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug.
Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.

References

  1. Rovin B, Roncone D, McKinley A, Nadasdy T, Korbert S, Schwartz M: APOE Kyoto mutations in European Americans with lipoprotein glomerulopathy. N Engl J Med 2007;357:2522–2524.
  2. Saito T, Matsunaga A, Oikawa S: Impact of lipoprotein glomerulopathy on the relationship between lipids and renal diseases. Am J Kidney Dis 2006;47:199–211.
  3. de Knijff P, van den Maagdenberg A, Frants R, Havekes L: Genetic heterogeneity of apolipoprotein E and its influence on plasma lipid and lipoprotein levels. Hum Mutat 1994;4:178–194.
  4. Lalazar A, Weisgraber K, SC.Jr R, Giladi H, Innerarity T, Levanon A, Boyles J, Amit B, Gorecki M, Mahley R, Vogel T: Site-specific mutagenesis of human apolipoprotein E: receptor binding activity of variants with single amino acid substitutions. J Biol Chem 1988;263:3542–3545.
  5. Ando M, Sasaki J, Hua H, Matsunaga A, Uchida K, Jou K, Oikawa S, Saito T, Nihei H: A novel 18-amino acid deletion in apolipoprotein E associated with lipoprotein glomerulopathy. Kidney Int 1989;56:1317–1323.

    External Resources

  6. Konishi K, Saruta T, Kuramochi S, Oikawa S, Saito T, Han H, Matsunaga A, Sasaki J: Association of a novel 3-amino acid deletion mutation of apolipoprotein E (Apo E Tokyo) with lipoprotein glomerulopathy. Nephron 1999;83:214–218.
  7. Matsunaga A, Sasaki J, Komatsu T, Kanatsu K, Tsuji E, Moriyama K, Koga T, Arakawa K, Oikawa S, Saito T, Kita T, Doi T: A novel apolipoprotein E mutation, e2 (Arg25Cys), in lipoprotein glomerulopathy. Kidney Int 1999;56:421–427.
  8. Ogawa T, Maruyama K, Hattori H, Arai H, Kondoh I, Egashira T, Watanabe T, Kobayashi Y, Morikawa A: A new variant of apolipoprotein E (Apo E Maebashi) in lipoprotein glomerulopathy. Pediatr Nephrol 2000;14:149–151.
  9. Oikawa S, Matsunaga A, Saito T, Sato H, Seki T, Hoshi K, Hayasaka K, Kotake H, Midorikawa H, Sekikawa A, Hara S, Abe K, Toyota T, Jingami H, Nakamura H, Sasaki J: Apolipoprotein E Sendai (arginine 145–>proline): a new variant associated with lipoprotein glomerulopathy. J Am Soc Nephrol 1997;8:820–823.
  10. Hoffmann M, Scharnagl H, Panagiotou E, Banghard W, Wieland H, März W: Diminished LDL receptor and high heparin binding of apolipoprotein E2 Sendai associated with lipoprotein glomerulopathy. J Am Soc Nephrol 2001;12:524–530.
  11. Ishigaki Y, Oikawa S, Suzuki T, Usui S, Magoori K, Kim D, Suzuki H, Sasaki J, Sasano H, Okazaki M, Toyota T, Saito T, Yamamoto T: Virus-mediated transduction of apolipoprotein E (APOE)-Sendai develops lipoprotein glomerulopathy in APOE-deficient mice. J Biol Chem 2000;275:31269–31273.
  12. Murano T, Matsumura R, Misawa Y, Ozaki H, Miyashita Y, Yoshida S, Sueioshi M, Sugiyama T, Shirai K: Interaction of endothelial cells and triglyceride-rich lipoproteins with apolipoprotein E (arg–>cys) from a patient with lipoprotein glomerulopathy. Metabolism 2002;51:201–205.
  13. Chen S, Liu ZH, Zheng JM, Zhang X, Li LS: A complete genomic analysis of the apolipoprotein E gene in Chinese patients with lipoprotein glomerulopathy. J Nephrol 2007;20:568–575.
  14. Luo B, Huang F, Liu Q, Li X, Chen W, Zhou SF, Yu X: Identification of apolipoprotein E Guangzhou (arginine 150 proline), a new variant associated with lipoprotein glomerulopathy. Am J Nephrol 2008;28:347–353.
  15. Blasiole D, Older A, Attie A: Regulation of ApoB secretion by the LDL receptor requires exit from the endoplasmic reticulum and interaction with ApoE and ApoB. J Biol Chem 2008;283:11374–11381.
  16. Zhang B, Liu Z, Zeng C, Zheng J, Chen H, Li L: Clinicopathological and genetic characteristics in Chinese patients with lipoprotein glomerulopathy. J Nephrol 2008;21:110–117.
  17. Ieiri N, Hotta O, Taguma Y: Resolution of typical lipoprotein glomerulopathy by intensive lipid-lowering therapy. Am J Kidney Dis 2003;41:244–249.
  18. Oikawa S, Suzuki N, Sakuma E, Saito T, Namai K, Kotake H, Fujii Y, Toyota T: Abnormal lipoprotein and apolipoprotein pattern in lipoprotein glomerulopathy. Am J Kidney Dis 1991;18:553–558.
  19. Matsunaga A, Furuyama M, Hashimoto T, Toyoda K, Ogino D, Hayasaka K: Improvement of nephrotic syndrome by intensive lipid-lowering therapy in a patient with lipoprotein glomerulopathy. Clin Exp Nephrol 2009 Jul 15 [Epub ahead of print].
  20. Maruyama K, Arai H, Ogawa T, Tomizawa S, Morikawa A: Lipoprotein glomerulopathy: a pediatric case report. Pediatr Nephrol 1997;11:213–214.
  21. Cheung CY, Chan AO, Chan YH, Lee KC, Chan GP, Lau GT, Shek CC, Chau KF, Li CS: A rare cause of nephrotic syndrome: lipoprotein glomerulopathy. Hong Kong Med J 2009;15:57–60.
  22. Kinomura M, Sugiyama H, Saito T, Matsunaga A, Sada KE, Kanzaki M, Takazawa Y, Maeshima Y, Yanai H, Makino H: A novel variant apolipoprotein E Okayama in a patient with lipoprotein glomerulopathy. Nephrol Dial Transplant 2008;23:751–756.
  23. Hagiwara M, Yamagata K, Matsunaga T, Arakawa Y, Usui J, Shimizu Y, Aita K, Nagata M, Koyama A, Zhang B, Mastunaga A, Saku K, Saito T: A novel apolipoprotein E mutation, ApoE Tsukuba (arg 114 cys), in lipoprotein glomerulopathy. Nephrol Dial Transplant 2008;23:381–384.