Login to MyKarger

New to MyKarger? Click here to sign up.



Login with Facebook

Forgot your password?

Authors, Editors, Reviewers

For Manuscript Submission, Check or Review Login please go to Submission Websites List.

Submission Websites List

Institutional Login
(Shibboleth or Open Athens)

For the academic login, please select your country in the dropdown list. You will be redirected to verify your credentials.

Original Article

Editor's Choice - Free Access

Protein SYCP2 Is an Ancient Component of the Metazoan Synaptonemal Complex

Fraune J.a · Alsheimer M.a · Redolfi J.a · Brochier-Armanet C.b · Benavente R.a

Author affiliations

aDepartment of Cell and Developmental Biology, University of Würzburg, Würzburg, Germany; bLaboratoire de Biométrie et Biologie Evolutive, UMR CNRS 5558, Université de Lyon, Villeurbanne, France

Corresponding Author

Ricardo Benavente

Department of Cell and Developmental Biology

Biocenter, University of Würzburg

DE-97074 Würzburg (Germany)

E-Mail benavente@biozentrum.uni-wuerzburg.de

Related Articles for ""

Cytogenet Genome Res 2014;144:299-305

Abstract

During the first meiotic prophase, chromosome synapsis is mediated by the synaptonemal complex (SC), an evolutionarily conserved meiosis-specific structure. In mammals, 7 SC protein components have been identified so far. Despite some controversy in the past, we have shown that SC proteins are ancient in metazoans and very likely formed an ancestral SC structure in the ancestor of metazoans. Protein components SYCP1, SYCP3, SYCE2, and TEX12 were identified in basal-branching metazoans, while other components (SYCE1 and SYCE3) are more recent elements. However, the evolutionary history of mammalian SYCP2 is not known. Here, we investigated this aspect with the aid of bioinformatic tools as well as with RNA and protein expression analysis. We conclude that SYCP2 belongs to the group of ancient SC proteins that was already present in the common ancestor of metazoans more than 500 million years ago.

© 2015 S. Karger AG, Basel


Meiosis is a type of cell division that leads to the formation of haploid cells. It is divided into 2 sequent divisions: meiosis I and meiosis II. During the first meiotic division, the chromosome set is reduced to half by the separation of the homologous chromosomes. The sister chromatids are not separated until the second division, which is very similar to mitosis, finally providing 4 haploid germ cells from 1 diploid precursor.

Three meiosis-specific features need to interplay during the first division to achieve a successful chromosome reduction: (a) the cohesion of chromatids, which is protected at the centromeres during metaphase I to prevent a premature separation of the sister chromatids; (b) the recombination of homologous chromosomes that provides interconnection (chiasmata) of the homologous chromosomes, and (c) a stable synapsis of the homologous chromosomes, which is mediated by the synaptonemal complex (SC) [Page and Hawley, 2004].

In the electron microscope, a typical SC appears as a ladder-like structure interconnecting the homologs over their entire length [Fraune et al., 2012a]. Its assembly starts during leptonema with the formation of the axial elements. As meiosis progresses, during zygonema, axial elements (now called lateral elements, LEs) recruit numerous transverse filaments (TFs), which in a zipper-like manner overlap and interact with TFs from the opposing LEs, hence initiating the formation of the central element (CE), which stabilizes the interactions of the TFs. SCs are fully assembled in pachynema and become disassembled during diplonema of the first meiotic prophase [Zickler and Kleckner, 1999; Page and Hawley, 2003; Fraune et al., 2012a].

The tripartite structure of the SC (LEs, TFs, CE) is highly conserved in sexually reproducing organisms [Gillies, 1975; von Wettstein et al., 1984]. Very recently, we demonstrated that mammalian SC proteins derived from an ancient structure that was present in the ancestor of metazoans [Fraune et al., 2012b, 2013]. Noteworthy, the ancient origin of SC proteins was unexpected at that time, as the mammalian SC proteins do not share any detectable sequence homologies with the characterized SC proteins of the other metazoan meiosis model organisms, i.e. Drosophila melanogaster and Caenorhabditis elegans [Fraune et al., 2012b, 2013]. An in-depth phylogenetic analysis, however, finally disclosed the conservation of most characterized mouse SC proteins from basal branching metazoans to mammals [Fraune et al., 2012b, 2013]. Our previous studies demonstrated that the major structural SC proteins SYCP1, the protein of the TFs [Meuwissen et al., 1992], and SYCP3, a component of the LEs [Lammers et al., 1994], as well as the 2 CE proteins SYCE2 and TEX12 [Costa et al., 2005; Hamer et al., 2006] are ancient in Metazoa. Orthologs of all 4 proteins were found in several animal lineages, even down to the basal species Hydra, and were experimentally identified as protein components of the cnidarian SC. The deduced evolutionary sequence of SC formation further suggested that the mammalian components SYCE1 and SYCE3 - both specific components of the CE [Costa et al., 2005; Schramm et al., 2011] - newly emerged in the branches leading to Bilateria (SYCE1) and vertebrates (SYCE3), respectively. It appears likely that during the divergence of the ecdysozoan species strong diversification of the existing SC proteins might have occurred, which could explain the lack of sequence homology between the mammalian SC proteins and the SC components of D. melanogaster and C. elegans [Fraune et al., 2012b, 2013].

With SYCP2, a second major protein constituent of the LEs was identified in mammals, besides SYCP3 [Offenberg et al., 1998]. SYCP2 is the largest SC protein yet described and in the mouse consists of 1,500 amino acids. It appears to be involved in LE assembly as well as linking LEs and TFs [Offenberg et al., 1998; Yang et al., 2006; Winkel et al., 2009]. In contrast to the other mammalian SC proteins, the origin of mammalian SYCP2 has not been considered in previous analyses. Here, we investigated this aspect taking advantage of the vastly increasing number of genomic data referring to numerous different clades and species. Complementing bioinformatic results, we also performed expression analysis at the RNA and protein level.

Material and Methods

Sequence Analysis

Sequence analysis and assembly of the dataset were performed as described previously [Fraune et al., 2013]. Homologs of SYCP2 were retrieved from public databases at NCBI (http://blast.ncbi.nlm.nih.gov) and Ensembl (http://www.ensembl.org/index.html) with BLASTp and tBLASTn [Altschul et al., 1997] using the mouse SYCP2 (RefSeq: NP_796165.2) as query. Newly detected homologs were used as seeds for additional BLAST search attempts to detect more distantly related sequences as well. The identified sequences were used to build a specific HMM profile employing the HMMER 3.0 webserver (http://hmmer.janelia.org). The resulting profile was used to query the non-redundant database (hmmsearch option). The survey of public sequence databases allowed us to retrieve SYCP2 homologs. The corresponding protein sequences were aligned using MAFFT version 7 [Katoh and Standley, 2013] with the linsi option.

Sequence information of the Hydra vulgaris AEP transcriptome was obtained from the public database on the Compagen server [Hemmrich et al., 2012]. Annotated sequence alignments were designed using CHROMA version 1.0 [Goodstadt and Ponting, 2001]. The identity threshold for grouping of the residues was set to 60%. Seven groups were created, depending on different features of the amino acids: identical (*), charged (:), Ser/Thr (:), aliphatic (:), aromatic (:), polar (:), and hydrophobic (:).

Animals

H. vulgaris from the strain AEP [Martin et al., 1997] were cultured at 18°C following standard procedures [Lenhoff and Brown, 1970]. Testes formation was induced by feeding the animals daily for at least 1 week, then starving them for up to 5 days [Wittlieb et al., 2006].

cDNA Synthesis

RNA isolation was carried out as described previously [Fraune et al., 2013]. Synthesis of a HySycp2 cDNA fragment was performed by PCR using Phusion® DNA polymerase (Thermo Scientific, St. Leon-Rot, Germany) and the following primer pair: HySycp2_part_5′ ATGGTTTCAATTGATGACCG and HySycp2_shortpart_3′ CATAGAATCATCTTGGACATAAGTTG (60°C annealing temperature). The amplified fragment was cloned into the pSC-B-amp/kan PCR cloning vector (Agilent Technologies, Böblingen, Germany) and sequenced by GATC (Konstanz, Germany).

In situ Hybridization

In situ hybridization was performed on whole animals as reported in earlier studies [Grens et al., 1996; Fraune et al., 2012b]. The antisense RNA probe of 297 bp used in the current study was synthesized from the cloned cDNA of HySycp2.

Antibodies

The cDNA sequence coding for a HySYCP2 polypeptide with 99 amino acids (see above) was cloned into pET21a vector (Novagen, Darmstadt, Germany) in frame to the sequence coding for a C-terminal His-tag. Following bacterial expression, the His-tagged polypeptide was purified using a nickel-nitrilotriacetic acid agarose matrix (Qiagen, Hilden, Germany). The purified peptide was used to generate anti-HySYCP2 antibodies in rabbit and guinea pig, respectively. Immunization was conducted by Seqlab (Göttingen, Germany). The final bleedings were affinity purified with the HiTrap system according to the manufacturer's protocol (GE Healthcare, Munich, Germany). Rabbit anti-HySYCP1 and anti-HySYCP3 antibodies were described elsewhere [Fraune et al., 2012b]. Anti-actin antibody (A4700) was purchased from Sigma (Steinheim, Germany).

Immunoblot Analysis

For immunoblot analysis, protein probes of different fractions of Hydra (head, mid-piece, foot, and testis) were separated on an 8% (v/v) acrylamide gel and transferred to a nitrocellulose membrane at 25 V for 16 h at 4°C using a wet/tank blotting system (Bio-Rad Laboratories, Munich). Detection of the HySYCP2 protein was done according to previous protocols [Fraune et al., 2012b] with minor changes. The nitrocellulose membrane was blocked overnight in PBS containing 0.2% Tween-20 (PBST) and 5% milk at 4°C. Afterwards, the membrane was incubated with rabbit anti-HySYCP2 antibodies (1:20,000) or mouse anti-actin antibody (1:10,000) diluted in PBST containing milk for 16 and 2 h, respectively. Secondary antibodies (goat anti-rabbit or anti-mouse peroxidase conjugate; Dianova, Hamburg, Germany) were used at a dilution of 1:10,000 in PBST with 5% milk for 1 h at room temperature. All washing steps were performed using PBST.

Immunocytochemistry

Immunofluorescence microscopy on cryosections of Hydra testis and on chromosome spreads [de Boer et al., 2009] of Hydra spermatocytes was carried out following the protocols in Fraune et al. [2012b]. The affinity-purified guinea pig anti-HySYCP2 antibodies were used at a dilution of 1:200.

Microscopy and Imaging

Confocal images were taken using a Leica TCS-SP2 confocal laser-scanning microscope (Leica, Wetzlar) equipped with a 63×/1.40 HCX PL APO lbd.BL oil immersion objective. Immunofluorescence images in the current study represent 2D projections from series of ∼20 optical sections per cell, generated by the maximum projection algorithm (Leica). The images were pseudocolored using the Leica TCS-SP2 software. Final processing of the digital images was done with Adobe Photoshop CS5 (Adobe Systems). Imaging of whole-mount in situ hybridization was performed using the Binocular SZ 61 (Olympus, Hamburg), equipped with the EC3 camera (Leica).

Results and Discussion

SYCP2 Homologs Are Ancient in Metazoa

An intensive database survey identified potential homologs of the mammalian SYCP2. Significant hits were detected in major metazoan phyla including Placozoa, Cnidaria, Crustacea, Plathelminthes, Annelida, Mollusca, Echinodermata, and several vertebrate classes. Most prominent sequence similarities were found in regions corresponding to the N-terminal part of the mouse SYCP2 protein (GenBank Acc. No. NP_796165). Accurate sequence comparison further revealed a region of 108 amino acids (amino acids 211-318 of the mouse SYCP2), which is highly conserved even between distant metazoan clades as exemplified by the CHROMA alignment of a representative taxonomic sample of SYCP2 homologs (fig. 1). The broad taxonomic distribution of SYCP2 homologs in Metazoa suggested that this protein is ancient in Metazoa. Then, the question is whether this ancestral SYCP2 was part of a SC in the ancestor of Metazoa or if SYCP2 was recruited secondarily in the mammalian SC. To address this question, we investigated the function of the SYCP2 homolog found in an early diverging metazoan lineage, the cnidarian species H. vulgaris (GenBank Acc. No. XP_004210390).

Fig. 1

Multiple sequence alignment of selected SYCP2-related peptide sequences from mammals (Homo sapiens, Hos; Mus musculus, Mum), birds (Gallus gallus, Gag; Zonotrichia albicollis, Zoa), reptiles (Alligator mississippiensis, Alm; Anolis carolinensis, Anc), amphibian (Xenopus tropicalis, Xet), fishes (Danio rerio, Dar; Callorhinchus milii, Cam) and various invertebrate species from different clades (Aplysia californica, Apc; Alvinella pompejana, Alp; Nematostella vectensis, Nev; Hydra vulgaris, Hyv). The alignment was annotated using the CHROMA software package. Identical residues are marked with an asterisk in the consensus line, while colons indicate residues with similar features. The threshold for grouping of the residues was set to 60%.

http://www.karger.com/WebMaterial/ShowPic/154944

Expression Analysis of Hydra SYCP2

To answer the question on the identity and possible function of the putative Hydra SYCP2 homolog, we performed a detailed expression analysis of the identified sequence in H. vulgaris AEP at the mRNA and protein level. Using the detected H. vulgaris protein sequence as seed, we searched for H. vulgaris AEP transcriptome data [Hemmrich and Bosch, 2008; Hemmrich et al., 2012] coding for SYCP2-related sequences. We identified a related contig (HAEP_T-CDS_v02_43970) coding for a 99- amino-acid-long peptide, which aligns to the H. vulgaris sequence with a sequence identity of 96%. Using sequence-specific primers, we amplified a 297-bp-long cDNA sequence corresponding to part of the coding sequence of the putative H. vulgaris AEP SYCP2 gene (for primer sequence, see Material and Methods). This cDNA fragment was used as a template to synthesize a specific antisense RNA probe for whole-mount in situ hybridization. The analysis yielded a strong signal in the basal layer of the testes, which mainly harbors meiotic cell types (fig. 2A) [Kuznetsov et al., 2001; Fraune et al., 2014]. No additional signals were detected in the Hydra body. A comparison of the obtained staining pattern with those of previous in situ hybridizations against mRNAs encoding already characterized Hydra SC proteins demonstrated a remarkable similarity [Fraune et al., 2012b, 2013]. The testis-specific expression was confirmed by RT-PCR. For this experiment, 4 different tissue fractions (i.e. head, mid-piece, foot, and testis) were prepared [Fraune et al., 2012b]. Under these experimental conditions, a signal was exclusively detected in the testis fraction, revealing a PCR product of ∼300 bp (fig. 2B). The size of the band was as expected since the same primer pair as for cDNA cloning (297 bp amplified) was used.

Fig. 2

Expression analysis of the cnidarian SYCP2-homologous sequences at the mRNA (A, B) and protein (C) levels. The HydraSycp2 mRNA is specifically expressed in the testis as can be seen by the purple staining of the Hydra testis base in whole-mount in situ hybridization (A) and the specific signal in the testis lane in RT-PCR on different tissue fractions (head, mid-piece, foot, testis) (B). Actin mRNA was amplified as internal control of equal cDNA concentrations within the fractions. C Western blot analysis confirms testis-specific expression at the protein level. A prominent protein band of the expected molecular mass (150 kDa) is detected by the anti-HySYCP2 antibody in the testis fraction. For gel loading control, actin was detected by a mouse anti-actin antibody.

http://www.karger.com/WebMaterial/ShowPic/154943

Next, the expression of the putative Hydra SYCP2 homolog was characterized at the protein level. To this end, we raised antibodies against the corresponding protein fragment of Hydra (99 amino acids encoded by the amplified cDNA described above). The Western blot analysis yielded a prominent signal, which exclusively appeared in the testis lane. Hydra head, mid-piece and foot protein fractions were negative. The testicular protein recognized by the antibody has a calculated mass of 150 kDa (fig. 2C). The size of this protein band is in good agreement with that of mouse SYCP2, which comprises 1,500 amino acids.

Finally, the antibodies were used to localize the protein by immunofluorescence microscopy. On cryosections from Hydra testes, the antibody recognized thread-like nuclear structures in spermatocytes that correspond to SCs (fig. 3, insets). The signal was specific for spermatocytes as no signal was observed within any other cell type. As in previous studies, double-label immunofluorescence microscopy on chromosome spreads at different meiotic stages was used to demonstrate SYCP2 localization (fig. 4) [Fraune et al., 2012b, 2013]. As already described in other species, HySYCP2 colocalizes with the LE protein HySYCP3 but not with the central region (CR)-protein HySYCP1. This is particularly evident during diplonema (fig. 4B, C) when LEs are still present but CR disassembly has already started. As expected for a LE-specific protein, HySYCP2 antibodies label LEs even at the sites lacking a CR (fig. 4C, insets).

Fig. 3

Immunofluorescence staining of HySYCP2 on cryosections of Hydra testis. A The anti-HySYCP2 antibody recognizes thread-like structures specifically within the spermatocytes (SC), but not within spermatogonia (SG) or spermatids (SD). These thread-like structures correspond to SCs as shown at higher magnification (inset). B The same cryosection is shown after DNA labeling with Hoechst 33258. Bars = 50 µm.

http://www.karger.com/WebMaterial/ShowPic/154942

Fig. 4

Immunofluorescence staining of HySYCP2 on chromosome spread preparations of Hydra spermatocytes. A Immunostaining using anti-HySYCP2 antibodies reveals localization of HySYCP2 within the SCs of Hydra spermatocytes. B, C Co-staining with antibodies to TF protein HySYCP1 in pachytene spermatocytes (B) and HySYCP3 of the LEs in diplotene spermatocytes (C) confirmed the localization of HySYCP2 within the LEs of the SC. At higher magnification, HySYCP2 can be detected along the separating LEs during SC disassembly in diplotene (C). Bars = 10 µm.

http://www.karger.com/WebMaterial/ShowPic/154941

Concluding Remarks

The protein investigated here is a component of SC lateral elements of the basal metazoan Hydra. We identified it as a homolog of mouse SYCP2, which is why we named it HySYCP2. Therefore, we conclude that protein SYCP2 belongs to the group of ancient SC components, which together with SYCP1, SYCP3, SYCE2, and TEX12 [Fraune et al., 2013] were already present in the last common ancestor of Metazoa over 500 million years ago and gave rise to modern SCs in present-day animals.

Acknowledgements

We thank Thomas Bosch (University of Kiel) for generous supply of Hydra cultures. This study was supported by the DFG Priority Program (SPP1348): Mechanisms of genome haploidization and the French National Agency for Research (ANR-10-BINF- 01-01). C.B.-A. is a member of the Institut Universitaire de France.


References

  1. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, et al: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389-3402 (1997).
  2. Costa Y, Speed R, Öllinger R, Alsheimer M, Semple CA, et al: Two novel proteins recruited by synaptonemal complex protein 1 (SYCP1) are at the centre of meiosis. J Cell Sci 118:2755-2762 (2005).
  3. de Boer E, Lhuissier FG, Heyting C: Cytological analysis of interference in mouse meiosis. Methods Mol Biol 558:355-382 (2009).
  4. Fraune J, Schramm S, Alsheimer M, Benavente R: The mammalian synaptonemal complex: protein components, assembly and role in meiotic recombination. Exp Cell Res 318:1340-1346 (2012a).
  5. Fraune J, Alsheimer M, Volff JN, Busch K, Fraune S, et al: Hydra meiosis reveals unexpected conservation of structural synaptonemal complex proteins across metazoans. Proc Natl Acad Sci USA 109:16588-16593 (2012b).
  6. Fraune J, Brochier-Armanet C, Alsheimer M, Benavente R: Phylogenies of central element proteins reveal the dynamic evolutionary history of the mammalian synaptonemal complex: ancient and recent components. Genetics 195:781-793 (2013).
  7. Fraune J, Wiesner M, Benavente R: The synaptonemal complex of the basal metazoan Hydra: more similarities to vertebrate than invertebrate meiosis model organisms. J Genet Genomics 41:107-115 (2014).
  8. Gillies CB: Synaptonemal complex and chromosome structure. Annu Rev Genet 9:91-109 (1975).
  9. Goodstadt L, Ponting CP: CHROMA: consensus-based colouring of multiple alignments for publication. Bioinformatics 17:845-846 (2001).
  10. Grens A, Gee L, Fisher DA, Bode HR: CnNK-2, an NK-2 homeobox gene, has a role in patterning the basal end of the axis in Hydra. Dev Biol 180:473-488 (1996).
  11. Hamer G, Gell K, Kouznetsova A, Novak I, Benavente R, Höög C: Characterization of a novel meiosis-specific protein within the central element of the synaptonemal complex. J Cell Sci 119:4025-4032 (2006).
  12. Hemmrich G, Bosch TC: Compagen, a comparative genomics platform for early branching metazoan animals, reveals early origins of genes regulating stem-cell differentiation. Bioessays 30:1010-1018 (2008).
  13. Hemmrich G, Khalturin K, Boehm AM, Puchert M, Anton-Erxleben F, et al: Molecular signatures of the three stem cell lineages in Hydra and the emergence of stem cell function at the base of multicellularity. Mol Biol Evol 29:3267-3280 (2012).
  14. Katoh K, Standley DM: MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30:772-780 (2013).
  15. Kuznetsov S, Lyanguzowa M, Bosch TC: Role of epithelial cells and programmed cell death in Hydra spermatogenesis. Zoology 104:25-31 (2001).
  16. Lammers JH, Offenberg HH, van Aalderen M, Vink AC, Dietrich AJ, Heyting C: The gene encoding a major component of the lateral elements of synaptonemal complexes of the rat is related to X-linked lymphocyte-regulated genes. Mol Cell Biol 14:1137-1146 (1994).
  17. Lenhoff HM, Brown RD: Mass culture of hydra: an improved method and its application to other aquatic invertebrates. Lab Anim 4:139-154 (1970).
  18. Martin VJ, Littlefield CL, Archer WE, Bode HR: Embryogenesis in hydra. Biol Bull 192:345-363 (1997).
  19. Meuwissen RL, Offenberg HH, Dietrich AJ, Riesewijk A, van Iersel M, Heyting C: A coiled-coil related protein specific for synapsed regions of meiotic prophase chromosomes. EMBO J 11:5091-5100 (1992).
    External Resources
  20. Offenberg HH, Schalk JA, Meuwissen RL, van Aalderen M, Kester HA, et al: SCP2: a major protein component of the axial elements of synaptonemal complexes of the rat. Nucleic Acids Res 26:2572-2579 (1998).
  21. Page SL, Hawley RS: Chromosome choreography: the meiotic ballet. Science 301:785-789 (2003).
  22. Page SL, Hawley RS: The genetics and molecular biology of the synaptonemal complex. Annu Rev Cell Dev Biol 20:525-558 (2004).
  23. Schramm S, Fraune J, Naumann R, Hernandez-Hernandez A, Höög C, et al: A novel mouse synaptonemal complex protein is essential for loading of central element proteins, recombination, and fertility. PLoS Genet 7:e1002088 (2011).
  24. von Wettstein D, Rasmussen SW, Holm PB: The synaptonemal complex in genetic segregation. Annu Rev Genet 18:331-411 (1984).
  25. Winkel K, Alsheimer M, Öllinger R, Benavente R: Protein SYCP2 provides a link between transverse filaments and lateral elements of mammalian synaptonemal complexes. Chromosoma 118:259-267 (2009).
  26. Wittlieb J, Khalturin K, Lohmann JU, Anton-Erxleben F, Bosch TC: Transgenic Hydra allow in vivo tracking of individual stem cells during morphogenesis. Proc Natl Acad Sci USA 103:6208-6211 (2006).
  27. Yang F, De La Fuente R, Leu NA, Baumann C, McLaughlin KJ, Wang PJ: Mouse SYCP2 is required for synaptonemal complex assembly and chromosomal synapsis during male meiosis. J Cell Biol 173:497-507 (2006).
  28. Zickler D, Kleckner N: Meiotic chromosomes: integrating structure and function. Annu Rev Genet 33:603-754 (1999).

Author Contacts

Ricardo Benavente

Department of Cell and Developmental Biology

Biocenter, University of Würzburg

DE-97074 Würzburg (Germany)

E-Mail benavente@biozentrum.uni-wuerzburg.de


Article / Publication Details

First-Page Preview
Abstract of Original Article

Accepted: February 05, 2015
Published online: March 28, 2015
Issue release date: April 2015

Number of Print Pages: 7
Number of Figures: 4
Number of Tables: 0

ISSN: 1424-8581 (Print)
eISSN: 1424-859X (Online)

For additional information: https://www.karger.com/CGR


Copyright / Drug Dosage / Disclaimer

Copyright: All rights reserved. No part of this publication may be translated into other languages, reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, microcopying, or by any information storage and retrieval system, without permission in writing from the publisher.
Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug.
Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.

References

  1. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, et al: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389-3402 (1997).
  2. Costa Y, Speed R, Öllinger R, Alsheimer M, Semple CA, et al: Two novel proteins recruited by synaptonemal complex protein 1 (SYCP1) are at the centre of meiosis. J Cell Sci 118:2755-2762 (2005).
  3. de Boer E, Lhuissier FG, Heyting C: Cytological analysis of interference in mouse meiosis. Methods Mol Biol 558:355-382 (2009).
  4. Fraune J, Schramm S, Alsheimer M, Benavente R: The mammalian synaptonemal complex: protein components, assembly and role in meiotic recombination. Exp Cell Res 318:1340-1346 (2012a).
  5. Fraune J, Alsheimer M, Volff JN, Busch K, Fraune S, et al: Hydra meiosis reveals unexpected conservation of structural synaptonemal complex proteins across metazoans. Proc Natl Acad Sci USA 109:16588-16593 (2012b).
  6. Fraune J, Brochier-Armanet C, Alsheimer M, Benavente R: Phylogenies of central element proteins reveal the dynamic evolutionary history of the mammalian synaptonemal complex: ancient and recent components. Genetics 195:781-793 (2013).
  7. Fraune J, Wiesner M, Benavente R: The synaptonemal complex of the basal metazoan Hydra: more similarities to vertebrate than invertebrate meiosis model organisms. J Genet Genomics 41:107-115 (2014).
  8. Gillies CB: Synaptonemal complex and chromosome structure. Annu Rev Genet 9:91-109 (1975).
  9. Goodstadt L, Ponting CP: CHROMA: consensus-based colouring of multiple alignments for publication. Bioinformatics 17:845-846 (2001).
  10. Grens A, Gee L, Fisher DA, Bode HR: CnNK-2, an NK-2 homeobox gene, has a role in patterning the basal end of the axis in Hydra. Dev Biol 180:473-488 (1996).
  11. Hamer G, Gell K, Kouznetsova A, Novak I, Benavente R, Höög C: Characterization of a novel meiosis-specific protein within the central element of the synaptonemal complex. J Cell Sci 119:4025-4032 (2006).
  12. Hemmrich G, Bosch TC: Compagen, a comparative genomics platform for early branching metazoan animals, reveals early origins of genes regulating stem-cell differentiation. Bioessays 30:1010-1018 (2008).
  13. Hemmrich G, Khalturin K, Boehm AM, Puchert M, Anton-Erxleben F, et al: Molecular signatures of the three stem cell lineages in Hydra and the emergence of stem cell function at the base of multicellularity. Mol Biol Evol 29:3267-3280 (2012).
  14. Katoh K, Standley DM: MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30:772-780 (2013).
  15. Kuznetsov S, Lyanguzowa M, Bosch TC: Role of epithelial cells and programmed cell death in Hydra spermatogenesis. Zoology 104:25-31 (2001).
  16. Lammers JH, Offenberg HH, van Aalderen M, Vink AC, Dietrich AJ, Heyting C: The gene encoding a major component of the lateral elements of synaptonemal complexes of the rat is related to X-linked lymphocyte-regulated genes. Mol Cell Biol 14:1137-1146 (1994).
  17. Lenhoff HM, Brown RD: Mass culture of hydra: an improved method and its application to other aquatic invertebrates. Lab Anim 4:139-154 (1970).
  18. Martin VJ, Littlefield CL, Archer WE, Bode HR: Embryogenesis in hydra. Biol Bull 192:345-363 (1997).
  19. Meuwissen RL, Offenberg HH, Dietrich AJ, Riesewijk A, van Iersel M, Heyting C: A coiled-coil related protein specific for synapsed regions of meiotic prophase chromosomes. EMBO J 11:5091-5100 (1992).
    External Resources
  20. Offenberg HH, Schalk JA, Meuwissen RL, van Aalderen M, Kester HA, et al: SCP2: a major protein component of the axial elements of synaptonemal complexes of the rat. Nucleic Acids Res 26:2572-2579 (1998).
  21. Page SL, Hawley RS: Chromosome choreography: the meiotic ballet. Science 301:785-789 (2003).
  22. Page SL, Hawley RS: The genetics and molecular biology of the synaptonemal complex. Annu Rev Cell Dev Biol 20:525-558 (2004).
  23. Schramm S, Fraune J, Naumann R, Hernandez-Hernandez A, Höög C, et al: A novel mouse synaptonemal complex protein is essential for loading of central element proteins, recombination, and fertility. PLoS Genet 7:e1002088 (2011).
  24. von Wettstein D, Rasmussen SW, Holm PB: The synaptonemal complex in genetic segregation. Annu Rev Genet 18:331-411 (1984).
  25. Winkel K, Alsheimer M, Öllinger R, Benavente R: Protein SYCP2 provides a link between transverse filaments and lateral elements of mammalian synaptonemal complexes. Chromosoma 118:259-267 (2009).
  26. Wittlieb J, Khalturin K, Lohmann JU, Anton-Erxleben F, Bosch TC: Transgenic Hydra allow in vivo tracking of individual stem cells during morphogenesis. Proc Natl Acad Sci USA 103:6208-6211 (2006).
  27. Yang F, De La Fuente R, Leu NA, Baumann C, McLaughlin KJ, Wang PJ: Mouse SYCP2 is required for synaptonemal complex assembly and chromosomal synapsis during male meiosis. J Cell Biol 173:497-507 (2006).
  28. Zickler D, Kleckner N: Meiotic chromosomes: integrating structure and function. Annu Rev Genet 33:603-754 (1999).
ppt logo Download Images (.pptx)


Figures
Thumbnail
Thumbnail
Thumbnail
Thumbnail

Tables